Description :
Non Conding Region
Location :
Scaffold_1:20659- 21084
Sequence
425 bases(100 bases per row)
CAAGCCCACGTAGAAGATGGGGTGCGTCCGCATCTTCTTCGGAAGATTGAGCGTGTACGCAAGGCCCTCGTTGGCCACAACATTGAAAGGTCCGATGAAG
CGCGGGCGCAACTTCGTCTTGAAGACGGCAGACACTGCATGTGTAGGTAGGTTCTTAGCATTAAGCAGCACCAGGTCCCCGACCTCATAACTTTCAACAT
TGCCTCTGCTCCTGGCATCTGCATGTTCCTTTTGCTTGTCTTGGCTCTCAGCCATTGCGTCAGGCACATGTCGTAAGACACTCAGACGCGTCGACAAGAA
AGCGTCAACCTGTTTACGAATAGTAGCCGGACTGACATCGGCTAGCCGATCAGCTAAATCGGCTTCTCCTCCCCCACCAAGCCCGAGGCCACCATCAGCG
GGACGCGGGGATGAGACAAGCTGTT