Description :
Non Conding Region
Location :
Scaffold_1:20530- 21828
Sequence
1298 bases(100 bases per row)
GTCTCGACATCACTTGATTCGCCGTCGTCGCTGATGTCATCTGCGTCGACTCCCTCAGTCGGAATATCCGCTACTGACGGCTTAAAAGCCGTGAATCGGA
CTCAGTAAGACATGCAGAAGCCCACAGAACTCCGGGTTTTGCCGGGTTTGAGCCTTAACCCGTTTTCAACGGAGTCCTAGCTATTCATTTGCATTGGCAT
ATATGTTGTGACTTTGGCGTGTGAGCTTTCATACACGTTGTGACACGAGTTACCTTTCATACACTTACTGTCGATACTGATAACCCCGACATACACCTAT
TGACACATGTTAACCGCTTTTGACAAAACGTTTCCAATTCATACACCTTTTGACGTTTCCCCACCTTGAAACCAAGAGGGCAGATCGCTTGGCTTTGTGG
AGATGACACGGCTTCCCGCCACCTGGAACTTCCCGACCAATTTGTGTGCATGTAATTCATGGTGCCAAGCAATGCATGTATTGTGTTGCGCGGCCAGGTG
GCTGTCCCAGTCCTAGCGTTTGCTTTTGGCCAGCATCAACTCGCAATGCACTTTACATTACAGATCATGTTGTCACAGCAGCAGCGTGAGGTTCCTCGAT
CGACGTCACGCCAATCGCGCCGCTTCGAAGCAACTGCAACAAGTCAGCACGAATACACAGTTCACCCGAGGAAACCGTGGCATGCATGACACAGTAGTCT
GCAGCATCGGAGGCAACGCTCTTGACCTTCGTAAGTTGAAGACGTCGACGCTAAAGCGCGACAAGCAGCAACACTTGGCGCAGTCCGAGGCCAAGCGGGG
GCGTGGAACAATGCCATCGGGGACTTGTCCTTCGCAAATCGGCCGAGATCTTGAGGAGAAGCAAGGACGACCAGCTGATGGAGCGATCACCGCCGGCTGG
CTCGGCCGAGTTCGCGCGAACGCCAAGCTGTCCCACCATTGCACGCGTCAGCAACGCCCTTGCAGCGCGGTGACAGATGGGGGACATCAAGAGATGTGGC
GGTCGGCCGGAGCTGCCGAAAGCTCGCGCGAGCTGTCGGCCTCACTCTCAACTTGGCCAGCTAGAGCAGAGGTCCTTGGTGCGTACAGCCCCAAGATCGA
TACCTAGCAAGCGTAGCGACCACAAAGAGACGTCGGGTGCAGTACAGTCCGGTGTCACGATGCCTCGGCACAACGCCAATTCGTTCTCGGACTCGCAATC
CTCCGGCCGGTAATTGCGCGGAATCTACCCCGCTTGGTAGAACGACTACAGTATAGCTGACTGACTGTCATCCGATTCCAGGGACTCAAGCGAGACCA