Description :
Non Conding Region
Location :
Scaffold_1:20413- 20652
Sequence
239 bases(100 bases per row)
AAGGAACGATGCGACCGCAGTTCTTTTACTCTTCGATAGTCATAGGAGACACACAGAGACAGACAAACAAAACAAGGCAAGGCAGCGCAGGCTATTGTAC
AATGAAGCAGGTTGTTTGATGGCATGGTGATTCTTCATCAATGCTCCACTCGTTATTCCTTTGTGCATATATGTTCAGATGTACAGGTAGGTCTATTGCT
CAGAGCTCTTTCTTCTCCATCGTGTGTAGTTATTCTAGT