Description :
Non Conding Region
Location :
Scaffold_1:20368- 20472
Sequence
104 bases(100 bases per row)
TATTTAAGTCGATTGGGAATAAATAACATACATCCGTCGTTTGCGAGTGCATCGCTGGTGCTTTGACTACTTACATAATGGACATGGGCTGAATTGCGCT
TACT