Description :
Non Conding Region
Location :
scaffold_1:20297- 20509
Sequence
212 bases(100 bases per row)
TTCCTCCTTCACGAGTTCAAAGTAAATTGCAGACTGTCTGCCTGCCAGGTGGTGTCCATTTGCTCACAAATTGATTGTGGACGTCTCTGACCCGCCATTT
CAAGAGTGAGTTGCCTTTTTGTGGCGCCAAAATCCACGCGTATCTCTGATTGGTCAATATGCTTCAACGTCATGTGAAACCCCTCCAGCGGCTCAGTCCC
AAAAGGCCGCGA