Description :
Non Conding Region
Location :
Scaffold_1:20199- 20294
Sequence
95 bases(100 bases per row)
AGTCTGAATCTGTTGCGGATCTTTCGCTGTTGGGACGATTTTACCGACGGTTTAGATATATCTATATCCAGAAGCACGATCACTACCAAGCAACA