Description :
Non Conding Region
Location :
Scaffold_1:19708- 19793
Sequence
85 bases(100 bases per row)
TGTGAGTCATGAAAACTAGTTGTCGTAGCACGGTGCTACTAGCATCACATGGTGCAAGGAAAATTGCCAGTGATCATCCAATATT