Description :
Non Conding Region
Location :
Scaffold_1:19617- 21922
Sequence
2305 bases(100 bases per row)
CGAGATGAGAAGATATAAATCATTTCAAGATCACATTTTCTCTGTTCGGCTCAAAGGAAGTCGCCGACGAGAATGCGCTATAAGTTTATCGTCAGTTTCG
TATTGCCGAGAACTTTGTGACTTTAGCCAACGACGTGACTCTAGCGCTGGTAGTTCTTCTATCCGCCGTTTCGATGAGAATATAGCTGTTTTCAGGTACA
CGAAGCATCTTTTTAAGATAACAAGAGGATCAACTTGCTGATCAAACATGCTACAAATGGATTATTTCACCCCACAGCCACGAAATGATGCAAGATCTCT
TAATCAAATATGTTATGGCATTGCTAATTAAATCAAGCAATCTGATAATGCACCTGAACTAGGTGCTCATTTAGCAGCCCATAACGCACTATCATTACTT
AGGTAGTGGAATATAAAACCCTGGCTTTGTACACCCCTGGCGTCAAATAGAAGGGTGCCGTGTACAGTCAGCAAAGAAGATTGGCTGTGCAGCCATTTAA
TGCCAAGAGCTTTATCATGGGCTTGGAAGTGGATTTATCGAAAGGGGAAAGAAAATTGTACGACAGTTTAGATTCTCTGAGCGTGCGTGTGGATTCTAGT
GGCCTGACGATATCAAGTTCGATTTCCTCGGTCAACACCTCGTGGGTACGGTGCAGAAGTACTACCGTCGACAGGGGGAATGTTGGTGGTCATATAGTCA
AACTTTGGAACATGCAATCTAAAGGCTGCTCCAGACCTTCTCCACCAAGATTACACCTGCACAAAGCATGAAGTGTTTCACGGCGCCAAAAGCTATACAT
CGGATCTGGACAGATCAATTCTGTAATTGACCGCCGTAAGCGATGCTTGCGGAGGTGCTGACAGCCTTGTTCTGAGAAACATTTTTCACTATGCGGATTC
ATCAACAATGATGATGATGTTGTCCCGGCTGGACATCCATCGCGTGGATTATCTACGGCGAGCGGAAAAGTTATGCCACTTTGCACAGTCTATGGAGATT
GAGGTGCGCACGAAAAATTTCTGTCGCGACGTGGTGAATGTTATGAACCCGAGAAGATCTTCAAGATCAAGGGAAATAGCTACCATCATGGTCTGATTAA
GTGCTTTCGATGTAGAAAGGGGGTCACCAGAAGGCTACATGTCTTCGCCGAAAGAAGCAAATTCAGCAAGACTTTACCCTCGTGACTAGTACCGTGGGGC
GACGGCAAAGAGTCATTGGATTTTCGATAGTGGATCTAGTTGACAATTACTGAATGACCTGAATTTATGGGAAGGTTCTGTTGACTTCACTAGTGAATGT
CTGGTCGTCGCATCCGATGGAGAGCCGCTTCGGTACACGAAGCAAGGAATCGTAGTAGTCACGGTCAAGGCACTGGGTGTCCGGAAACCCTTCGACTTCT
CGATGTTCAGTACGCTGAACACCTACAGTGGAATATTTTTATTATAGTGAGCTCGAACTCAAAACGGTTTTGTACTCGAATATCGCGAAGGGAGGCGTGT
TTTTTTTCTTACACAGGAGACGTGGTAGTCATGGATGCTGATGGTGGAACAGAGGGTTTCTCGTTAGAGTCTACGATGAAGATTCCCGTGGGTGTATAGA
TGGCAGTATGGCAGTGCTTGCCGACACTGGACATACATCCGATTTGAATGTTTAATGTGGCTCATTGGTGGAAATTTATCGACGTCTGGATCATTTATGC
TATCACACCATTATCAAGATGGCCCTAAACCCTGCTTCTGGTTAACATGTTTTGAACAGCAAGTGGGTGTTCAAGTTAAGAGTAAAAAGGATGCGAATGG
TGACGTCGAGCGATACAAGGATCGAGTCGCATCATGCGGCAACAAACAACCCTTTGGTGTCGATTATACACTGACATTTGCTGCAGTGATGATTCTTAGC
ACAGTCAAGGTGATATACTTATTTTGTCAAGACGATGAAACGTTCCGGCACTTCATGGAGATGTGCCTATGTCAAAGCAGAAAAAAAGCGCATTTTAACG
CGTGCATCAAGGCTTCAAGCGAGATGGATATTGATCAGATGCATCTAAAAAGACATGGTGTGAAGGGCTCAAGTAGGCTGGCATTACTGCTGAAGAAATC
ATTGAATGGTTTGAAACAGGCTGGCAGACTTTGAAGCAAGCTATTGCACTCAAGATTGCGCATGGCGTGGTTTACGCAATGCAGGACGGATATGTGTCTA
TACTTCAAGAGAGTTAAAGACAAGCTCACTATAGTAGGAGTCTACCGAGACGACCTTCTGGTCAAAGGGACATCTAAGGTTGCAATGGACAAGTTTTTAA
AGAGA