Description :
Non Conding Region
Location :
Scaffold_1:19346- 20246
Sequence
900 bases(100 bases per row)
CTTGCCTGCGCCACCGAAACTACCGCCCACGAGCAAGCGTCAGTACAACAGCGCAAGCACAACAGGGTTTTCTCAGCGATTCTTTATGCGGAACCTTGTC
CTGTGACGACGAGGTAGAAGCTGTCGCCTGGATCTCCCTGATTATGTGCAGATCAGCGCAAAGATCGAATCCGATGCGAACCCTCAGCGATGCTTACTTC
ATGAAAAATGTACGCGCCGAGCTCTGTCAGAATTTTGGTGTCGAGTGCTTGATACAGGCGCTCCAGCTACTTCGAGGGCCACGATCACGCACAGTTTGAG
ATCGCCTACAGTGCAATAGCATCCAAGCAATCGGCCTCACTTTGTCTATTGTCAAACCAAGGAGAGAATGGCCCAATGTACTGGTCAGAGCGGCCGATGT
TCACAATGGTGCCAATAGAGTCGAACATACATGCGTCGAGGTTGGCAAAGAACTCCAGCAGCTTCGAGGACGAAAACAGCGACTTGAGCTGCCGAAGCAA
AGTCAAACATTGATAAAGTCTCTGTGAGCCCGACGCGTTTGACGCACCATGTGAATGTCGTCGAGCGTCCTCTTTCCGGGCGGCTTCTTGAGGATTTGGC
GGCAGTGGTCGATCTCCGGCCCGTTCTCCCGCATCAAGCGTTGGAACGTGCGCGTATCGACCACCATCTGCGTGCGAGACGCCAACGACTCGCGTCTCCC
CTTCGCCAAGTCCTCATCTCCACTTAGAGCGTTACTGGTCTTCCCCATCGTGTCCGCGGTGTGGATTAGCAGGCGTGGAGACGGATGCCCCGAAATACCT
CGAGCCAAATGCATACGAACTTAGCGCGAATTGAAGTGGACACTCGTAAGTTCGTTTTGCACCATCACTCTCTGCACAGATAGAGAACGCAGCGCCAAAA