Description :
Non Conding Region
Location :
Scaffold_1:19236- 20729
Sequence
1493 bases(100 bases per row)
TCCGTTTGGGGATAGTAAACGTCTCTTTGAGCTGCGAGATCACCACACGACCAAATGCAAGGAAAACAACAACGAAACGGAACCATGAAACGCACATTCA
TAAAATAAAAAATAAAACGCACCGCTACAGTCGCGCTGGATGCCGAGTGCCGCGGGCTGCGCCTCAATAATGACTTCTCCTTCTCCCTCGACTTCGTCTT
CCCTGTTGGTACTACCAGTATGCTAACTACCAATACACCAGAGAACCCTCCGTGTCTCTGATCGCTCTAGATTACATTATAACTTTGCTTGAGGTGTTTG
TGTCGTATCCGCTGCCACCAAGGTGCGGAGGTGGTGGTGTCTTGGCTTGAGAAAACAAAAGTGTGTGGACTGCTCGGATAGCCACGACCGACGCGATTCA
CGGCTGCAGCTCGCACGAAGCCAGCTGCTTCGCCGCGTCTTCGAAGGTCGGAGCATCGTATGCCGGACGCAAAAGAGAAAGAGCACGAGATCCACTGTCC
TTGAACGAAATCTCAGATGACTCGTCGTTGATTTCTTCCATGACGCTGTCTTCCAGGATCTCCGAACGCTCAAGCGACATATGCATGTCCGTCTTTTGGC
CGATTGTCTCTACTAGGTCGTCAAATAGACCGATCTTCCACGCGAGGTGTTTCTCCTCCAAGAAGTACCACACACGGTACGCGTCCCAAAAATGAGCGTT
ATCCAGCTTCTTTACAAGTGCGCCGTTTACTGAGTCACGGAACACCTTCTGGATTCGCTGCACGTCGACTTCTACGTTGGTCAGGTCCACGCCGTTGTTT
ACAAGGAAGCGCAGCAAAACCAGCAACTCGTACTCGGACGGCCGGTAGTGACCGCTGTGGGGATAAATAGTTTTAATGACCCCGTTCGAAATCACCATCA
TGCCGGCCGTCTGCACGCACTCGCCGCCTACGAAGCTCGTATGGTGAATTCGCGGAATCTTCTTCGTCTCTTTTTGCGAACCGTAGAGGACTCCATCGCG
CAACACAAAAATCCATCCATCCGGGCCCGTTTCCACGATCTCTTGCGAGGCGTCATGTACAATCACGCCATTCTGCACCGAGAGCGCAAACTTTTGGCGC
TCCGCAGCCGTGTCGCAGTACAACACCGTTTCACGCTCTAGTTTCGTTCTCGGTACACCAGCGACTTCAATCGATTCATCATCTAGCCACTCCCAAAAGC
TGGGCTTCGTAGGCTCCATCGGCTGGCGCTTCCATTCTTTGTAATACGCTCGCAGATTCGCACCATACCTGTCCAGCATCACACGTCCACACCAGCGTTA
GCGCTCCAATCTACCGTCGATCCTAAAGAGATGCACGGCGACGTACCGGTGCTTTCGATCGCAGACCTCGAGCCAGCTCTTCTTATCCACAACCGAAATA
TTTCCTGCGCTATAGCCCTTCACCAGCTTGGGCGAGTACTTCTTGGCTAGCTTGACGATCTCGTGCATGTTTTGGTAGGTGGTTCGTCGTTTG