Description :
Non Conding Region
Location :
scaffold_1:19151- 19336
Sequence
185 bases(100 bases per row)
TGTCACTGGTGTATGTAGTGCTCGGAGAGAGAGAAAAGAGGAACGAGCAAGTGGAGATTCTTCAATCAAAGTAGTCGCGCATGTTTGCGGTAAGATTGCA
AGCGAAATTAAACAAAGGTATGCTCGTCTACCTTGTCCAGCTTGTTCTACTGTTTACTACACTACAGTAGTAGATCGATCGTATC