Description :
Non Conding Region
Location :
Scaffold_1:1914- 2638
Sequence
724 bases(100 bases per row)
GTTACATCGGCAAGTCCGTCTTTGTGCACGAGGACATGTGTGCCAGCAGCATTTGTAAACATTCGGGTGCCGTCGGCATGGTATGTGATCCGTGCTCCGT
CAGTATGTGTAACAATCATGACGCCGCTTGCCCGTCTCTCCACAACTGCGTTCGTTTCCGGATCAACTATGAAGGTCGACGGAGTAGCGCAGGCTTCTGC
ATCGGTAACGCGCGGGGAGCCATTTTGAGACTTGTTGATAATGTAGACACTGCCGTCGGGGGACAAGATTTGTCTGGACTCGTCAGCAAACACGCGAAGC
ACACTGCCCTTTCCGTAAATCACGCGATATTCTTCCGACTCTTCTGGCCACTCGCGCATGGAGCTGTCTTCTTCGTCGTCACTGGATAGCTCACTAAAGT
GCGTGGATGGTCGGATGAACCTTTGGACAGTGGACCCATCAGATGATGTTGAAATCACAAGGCCGCACGGGAAAGTGTTGGAGACAGTGATCCCTGAGAA
CCCGTCAGGCTTCTTCGGAAACAACCGTTTTGACTCGCAAACATGGAGGCGAGTGTCATCTCCAAACGATGCGACGAACTGCACTGCATGAGTAGACATA
TTTGACGGCACACGATTCTCCAGAACTATCGGTCGAAAGCCAAACACATTGCTGGATTTGGGTGATTGAAGGTGCACGCGGTGTGAGTTCCGAGTATGAA
CAAAGTCAGTAACAATTCAGTACT