Description :
Non Conding Region
Location :
Scaffold_1:18940- 20311
Sequence
1371 bases(100 bases per row)
ACGACACTACTTATGACGAAGACGTCAGTGTAGAAGATATTATAATTCGTGCTTCGCAGTTGAGCTTTTAAAATATATTTTACGTGTATAGTACTTCATT
GTGGTCCCTTTATAATAAAATGGCAAATCTTAGGAGATGGTCGGACCTCGTTACCGGAAGTGAGAGCTTTTACTGTAGTTGATAGCCAGTGCAACCGGGT
CGAAACCCGGTGTAATACCACTGAGACCCGACCCGTTAGGAACCATTCGGACTAAAAGCACATCTCATTCCCACATCATCCGACTGAGAGACGAGCGGCA
ATGACTCGGGTGTCTGGGAAGCAAGCCCCACCGACGTACGCGCAGCACGAGCGTCGTTCGCACGCCGCGCGCACTACGACGACAGGCTACTTCAAGGCGA
AGTCGCGCAAAAGGCAACACATGCGACAGCGAGCTACTCGGCTCGAGCGTACCGTTGTGGCGTGATAAAGGTCGCGCCTTTGAACAAGTACAAGACCTTC
TCCAAGGGTGCATGCTACTCAGGGCCATTTATATCGCGGGTGGGCAAGACAGTGGCGGAGTGTCGCCATGAGGATGAGGCGCTTCGCGACATGGCATATT
TGGTCGACCTGACCAATGAAGAAGAGGACAGTGAACCGCGCGGAGCAGATAGGTGTAATGGTCCAGATCCTCCTACCTCCTGTGCTAGATCTCCGGTTCT
GCATGTCATCGTTTTGGACGGCACCAGTGATGACGACAAGCAAGAAGTGGAGCTTAGTGCTAGTACCATCGGTACGAATACACGAAACGAGCTTGCAAAC
AGCGTTGGTGTGGGTCATGTTGACCAGAGTGGTTCACCACTTTTACCACCAGAGGTTATTTGCTTGTTGAGTTCTAGCGACTCGGAGACATGCAGCGGTG
AATTGTTTGGAGCTGAAGAGAGGCGTCTATCGAATGCTGCGCTCGTCGAAAATACCAGAGTCGTCGCGGATGAAGCTCCACGCTCGCCTATCAGCCCAGA
AGTTATTTGCATCGATTTATCGAGTAATGACAGCGACAACAGCCCCAACGAGGACGACAGTCTAGTGGACAAAATAGAAGACGCAGACATACGGTCGTCC
TTGGACGGACCGCTCAGCGCGGTGGTGGGAAAGAAGAAAACGGATGATGGCGAGGTGCACGATCATTTTGGTGACAACGATGCCTACGAGGGAGATATGG
AATCAGAGCCAGAGGAAAATTCAAAATCACCGCTAAGTACCGAGCCAAGTCCTGATGCGGTTACACCGCGCCTGTATACAGAAGCTGATGCTGTTCCCTG
GCCAGAGCAAGTTGAGGAGATCACGCACACACAAAATCCATGCAAGATTGCTGTTCCAGATTTGGGATCGA