Description :
Non Conding Region
Location :
Scaffold_1:18889- 19908
Sequence
1019 bases(100 bases per row)
GCACACACACTCTCTGTCTGTCTGTCTCTGTATGGAAGTGGTTAAATGGAGGCGCAGACCAGTGGTGCGCGGGGGAAAGTGGCGTGGGGAATGAAGAAGA
TGAGGAATGGCGGGAGGGCGCGCGCTTTCTAGTACCTCTTCTCGCTTTGGTGGAATGTCGCGGGCGTGATGATGCTCGCCCGAGCGGATGGTATTACGGG
GCCATGCACTTGTCGGTCATTTACGATTCATTATCACAGCTGTACGAAATTTTATCGGAGATCATAACAATGAAGTTATGAGCTGATTTGCTATTTAAAA
AATGGTAGAGGGACGCAGCTTGAATTAATAAATTATAACAGGTTATAGATAATAGCTAGGCTTGATCAACAGAGTGAACGTTCCTTTTTGTTTAGCAACT
TGAGATGCTTCGAATAGAGCGCCGGGGGAACAAGGGCCTCTATTGAGAACCGCAGCATGTCGCACGCCTTGATTTTCTGAAATTAGGTTTTTACTGAATA
TGGGTGATTTGCACCATTTTGTGTATCCAAGTGGGGTGTTTTCTCATGTAATGTGGCAACAATGGAGATGGCCCTTCTTTCTTGTGGACATCAACCTCCC
ACCCACATCAGCCGAATTGGTTGAAGCGCAATCCGAAAAGCGTCATCTCCGGATTACGAGAAGTTCTGATTGTTGACTGCTCATCGCACGTTGGCCAACT
GTAGTAATCCAACCGACTGGGTGTCGAGCCGAAGCATTGGACCCATGAAGCTGCTGTGGGAGCATGGCATTTGCCGAGTCTCGGCTCTGTAACCATCATA
TTCACTGGTGCACCAACTCGGCTTCTTCGAATCACCTGAGACACAAAGTGGCTGCATGAGCTCAAGCGCAGTTCGTGTCGAAAAATACGAAGAGCGTTCA
TATATATTATCAGTAGCATCCTTTCATCGCCTGTTCAAATCCAAGCTGAAGGCGAGGACGTCTATCACGCCACGCGACGACCAGATTCCATGACCCACGG
CATCTTTTGGCAAAACACT