Description :
Non Conding Region
Location :
Scaffold_1:1868- 3577
Sequence
1709 bases(100 bases per row)
AGGTTTGCCTTCTGGAGTGACGACAGGTCCGACGCACGGCCAAATAGGTATCATAACAGGCACAACAGAGCGGCATCCTAGTAGTCGGTAGCATTCTTCG
CGGTTGAGTACTGGTAGACCATGAGAGTACGGAGACAGTCCTTAATGCACGCTGGGGCCTTCTTGATAAACCCACCCGAGTTGCGTTTCATGCAGTACCG
GTCGAGGGTTGAGCCCATTTTCAACAGCTTGGCGGAGACGGCGGCGCTAAGTTGGTAGAGTTCAATCAGCCACAACATGACGTGGCGGTAGTACAAAATG
ACTGTGTCCGAGCGATGTGTTTCCCACCCTTTGTGTCGAGGAATGCCAAGTACGACCCAAACTTGTCAAGCACACGTTCAATGGCAACGCCAGTAGGGTC
AAGAGCAAATTGTGCATGAATGTATTCCATTGTTACATTCTCTTCTGTGACAAAGCACGTAAACGACTTGATCGCTGTAGCATTCGCCTTGGTCGTGTTG
GCAGACACAAGATCTTGGATCCCCATGCAGAATGGTATGCCAAAGTGATTGCTACCAATTGTCCGAGCATAATATTATATGCAGGAAAATATGTGTTAAT
GCTAGCATTTGTATTGCACATATTCATATTTTGTGATCCATTCTGACAAATCTGTCCGAACTGGTCCGATCTTGTCCTAGCAATTACGTATACATCGATT
GGCTTAAATGTTCTCTAAAAACAACAAAATGCAAGTATAATTGGCTGGTAATCATGTCCCCGGGCCGGATTGGTTATAATTCCGGATACAATGCACAAGT
ATGTCCGCAAAGTGATCATATTCACCCATATTTAAAAACACCCATTCGTGAGTCAGTATATTATTTCAGCACGTGTGGTTCGTAATGGTATTCGTCCTTC
GAAGTAAGCAAGCCAATCAAATGACGCCATTCATGTCCCACTCGAATACAAAAGAGGCCTTGCATTCCGTAGTTCCTTGTATTTGTCGGATTTCCATACT
GTAGTACTATTATTAATACAGTAATAGTAAATTTTACATATGAAATCTGTTTTGCCAGTTACAAATTTGTTAGGTGGTTAACCGACGCCTCCCAAAAAGT
GATCTTAACGATAGTACAACTAGACCTCTTGACCAATGACTGAGCGTTTGTCGATAGACCCATCACATTCCAAACTCACTCTGTCAAATTTTATTCAATC
CTTCACATAATTTTGTGCCTCTACTTTTACGAAATGACTGAGTGATTAATTAACCAATAGACCGAGTCACATCCTTTGGATATTGTGACTTTATATTTAA
TTGCAACATTTACCAGTCACATAGTATTAATCAAAAATACCACTTGCATCATCACTATCAAAGTCAATTCGTAAATTGATTCGTCTATCGCGATATACAA
AGTCACTGGTTTTGAGGCTAACTGTACTACGTAGTACTATTTTCCCTATCTTTGGGCATGACTGGTGGGATTCGACACTGCAACTTTTACATTGAGGGGT
TTTGAATGTTAATATGATCGAATGAATGCAGCTCAAATCGGTTGATCCCAGATCCGTCAAGCTTTCCGCAGCCTCCTGTCACATATACGTGGAGATGATG
GAGTTCTCTGTCAATTACCGTATCATTACGAGATTAACATTCCTTTTTACACCAAATCACCTTTGCGAAAATATCATTTTCGTCGACCCCCTTTCCTTTC
CAAATCAAT