Description :
Non Conding Region
Location :
Scaffold_1:18544- 18997
Sequence
453 bases(100 bases per row)
TTGATGAAGAGCGAGAGAAAGCAAAGACTGTGGCTTGAGGGTTGAGAGACGCGCTCTTTACTCTTGCTCTGCGTAAGTGTGTATCTGTCTTTTAAAGCAG
CAAGAAAAGGAAACAAGAACAGCAGCACAGCAACGACACAAGAGCTCCTCAATCTCATTGAGCCGGCGCTCGCTTTTGTCTGTCTGCAACCATTTGTTGA
GCTCTTGACAGCTTTTTTGCTCGTCAAAGAGCGTGGCAATCCTCGTTTTAGTGACTTTTCCACCTCCTCAAACCGCGCGTGGGAAACAAAATGTTGCCTG
AAAATGTTGCGTCACTAAAGCGGATTCCTTGGCACCGCCCATTTATCTGACTGCTTTGAGTCTTTGAGGCAGGTCAGTCAGTCAGTCGATCCAATCAGCC
CAATCCTCCTCAACACACGACAACATTAGGAAGAGATAAGCCATAAGCCATCA