Description :
Non Conding Region
Location :
Scaffold_1:1851- 2382
Sequence
531 bases(100 bases per row)
CTCTCTCGTTTCACTCTTTTCGCTTTCTCGACCACACGCCGCAGGAGACACCCGTTTTGAGAGGCCCCCTGAGGCCACCTGAAGTCCCTCTTTATAATCG
ACATATTGACACAGCTGCGATATGAAACCAGAGCCAATGAAACAATGGCCACTTTTTCATACAATATCCTAGTTTAACAAAATGGATGCCAACCTCTTTA
TACTAGTTTAAAGAGGTGGACATCCCACTCGTGATTTACACTTGGGTTTTGTATGCCAAAATGGTCCCGGAGGTGCGGTTGCTCTGGAATGGATCAAGGC
TTCATCAGACTCACCCACGGCGACGCGTCGAGCTACTGGCGAAGTGGAAGGCAACAGCAGAATTTCAGATTACTTCGTTAGCTGCCTAGTCGAGTGGGCA
GGTGCTCCTCAGAAAACATGAGTAGATCGATACGAGGCAAAACACGTTTCCCAAGGTTCAGAGACTTTTTACTTGAGCCTCATCTCGCCCACGAGACCTC
CCGACATTTTCCATCTGCGGCGATACGTTCC