Description :
Non Conding Region
Location :
Scaffold_1:18476- 20829
Sequence
2353 bases(100 bases per row)
GCTCGTTGATGTGTCAGTGGATTTCTGATCCTGTTTTTTAACAACCTTATCTCTTGGTTGTCCAAGAAGCAAGACATTGTGACTCTGTCCACCACCGAGA
CCGAGTCTGTAGCTTTTGCCCTTTGCATTAAAGAAATGTTTATACATTCGGCAACTCGCTGTCGAACTACATCACACTAGTGATCAACCGATTTCGGTTC
ACGAGGACAATCAATCCGCCATCAGCATCGCTCAAAATACTGAGCATCATAGGCCACGTACCTTCGGGATGTCCTCGGGGAAGCAATCGAGGAGCCGTCA
GTCGTGCTGCTGGACAACTTCGAGTCACATGTGTCGGGTGAGTCGTACAACATCATGTACGACTAGGTGCCCACCTGTATGCGTTGCCACCGGACGCGAC
GTCCGTGTATCAACCCCTTGACGTTGGGGTGATGGCGCCACGTGGTAGTCGACCGTTTGAGCTGACTTGTAGCAGCGATTCATAGATGGCGACACGCTCC
TTGTGTTGAAAGTACTTAGTCATCGAGAGGAAGCGGCATGCGGTAGAGAGCTCGGTGGCGTAGCAGACGGCATCAATAGAGTCTTACGAATGTATCTTGT
ATTGACAACGACGGTCAAATTTGATAAATGAGCTCTCAGCGGGTATGTGTGTTTAGATTTTAGTTGCGACTTCGACTTTGACCAGCCATAATGTTTTGAG
TGAAAACGATTTGGAACGCTCAAAACAGAGCCAATCGAAGCAGGGAGCTTGCGCCATTTAACCAACCAATCAGATGTACAGAATATGCAAATTTAGAAGA
ATACCGCCAATAAGAACTCAAACCCAACTATCATTTCAGACCAGAGTAGTAGTAGTGATATTGATATTACGCTGTAAAGTTAAAATCACTCCGCGGGCAC
TTAATGGCCTCGGCCGCGTATCATGATACTGTAGTAGTCCGGAGCGAGGGATGATGCCACATACTACACCATTTTTCGTTTAAGTTCAGGTTATTTCCGG
TATATTCGTCCGACGCACAACTGATTCACGCCATGTGCGTTATGTTCGCCAAGCATTCAATATATTTCGTCCAGACCCTACGTCGTTGCATTATATTTCG
ACAAATGTACGGTATATACGTATAGGTTAGAATTTACCGTTGGAGATGCTCTGGTCACCCACTCGGGGGTGTTGGTTGTGTTTACAGCCGTTAGTACTGT
AGAGTGTTTTCACGATCCGGATACTTATCCAAATCACGGGTCCTCTTCATTCGGATATCACCTATTTCGTGACGGTTTCGTCGGAAAGTATGACGGGACC
CGGATTCGAACCGGGCCTTTGGGTGAAAAGACCGATGCTCTAACCAACTGAACTAATTGAACACCCTTAATCCATACTGTGCGTTTGGGCAAAACGAATC
TTTCGTTTTCAAATACTGGTCGGATTTAGCTCATTCTTTTCTTAATCGCTTCGTCTTGAATTAAAGATGATTAATCCCCAGTTTTGAAGGCTAAATATTA
ATGGTGATAAACTTATGTGCCTTCGCGACATGGGGAATCCTAGCATTTGCTTGGGTCGGATTGGCACGTATTGAAAATAAAATAACGTTCGCTCGAAATT
TTTAAAACTTGAAAAGAGAAAATCCACTACGGTAGTACTTGACTTTCAGTACTCCCGCTCGTATTTTTATAAGTACTATTTTTTATTTAAATATCGCTCT
TCTGAGTATGATTTCCCCCCTTAAACGAAACGGGGTAAACTTGATAATTTTTGAAACTTTATATTATCCAACCATATCGGAAGGTGATGACTTTTTCAAA
ATTCGAACACTTGAATCGTTTGGCATTGAAATGGATGACATCATTTCCACTGTGAGAAACTGCTGGAGACGCACTGGCATACTCAGCTCTGACTTGGAGA
CGCCCAGCGCTTGAATGCATGTATATATGGTTGGTTCAGACAGCCTGCAAATACCTGTAAGAGTTAATTTACTGTGTGAATTGCATAATTTGCTCCGTTT
CGTTTAAGGGTGGAGATCAGTATATTAATTTGCTCAGAATGTATGGCAGGAGCGAAATTTAAAACAACGATATCTATTTTAATATCCCGTTGTATTGATT
ATACAACCCCTCACCCGATGAACTGATTTCTCCTATATTCGTATATACCTTCAGATCTGAAAAGTGATACATGGGGGAAATGTTATGGAAGAATTAACCA
ATACATTCGTTTTGCCCAAACGCACGATAGTTTCATATAAAGCCCTAATGGTCTAGCGGTATGATTCCTGCTTCGGGTGCAGGAGGTCCCGGGTTCGATC
CCCGGTTGGGGCCACTTTTATTTAACCTTCGTTCTCGGAACAAAATCTTATGT