Description :
Non Conding Region
Location :
Scaffold_1:18247- 18804
Sequence
557 bases(100 bases per row)
TGGCGTATACTTGGTACACGCCATAATTACCACTTTCTTGGCAAGCGTGGCAGATGCCGCCTTTCACAATCGGCATCTGCCACGCTGTCAAAAGTGGCAT
ACTGCCACATTGCACCAGCTCATTGCACCATTTATTTGTGGCATTGCCAAGTTGAAGACAGGCGCCAAGAGCACGATCGGCACGAGTGGCTTCAACGTGC
GCGGCTCTGACACGTTGAATCTTGGTTGCGTCTTGGGTGGTCGCGTGTTCTTTGGGAAGCCACGACGTCACTGCTTCGTACGTTTTGTACTAACTAACTA
AGCGTGCACGGGGAACGAGGGACCTCTGGCGAGCCACAGAACCGAGAACCAACTCGATATCTATGGTATCCTGCTGTAGCCGCCTCGTGGCCGCTCCCGA
CGCCCGCGGGCCCCACGGGCGTCCTCTGGTCCTGTCTGTAACGCCGTATATTAAATGGTGCGTATTTTTGGAGACTTGGTGTTTGTATGGAACGCGCGAT
TTGTTTTTATTCCTGGTCGTGGATTTCTTGAAAAATCCAGTATCCACAGCTTAGCGA