Description :
Non Conding Region
Location :
scaffold_1:18164- 18656
Sequence
492 bases(100 bases per row)
CTAGCTGCTGTACTAGCCCTTTGGTGCTCACTGCTGAGCCTCTTGTTGCGATCTGGGCGGAAATGCAAGTGCGTTAACGTGTGGTGCGCAAACGATGAGC
TCTAGCGACCGGATTTGGCAGGGATGGTAGTGTGGAGGATTGAAGTTGGCTGTTCTATGCTATTTAAATGGGTCATTGTAAGGTACAGAATGAGCCTTGT
AAATTACATGCGCATTGTATATCATGATTTATGTGTTTCAAGAGGAAATATAGCGCACCGGAAAGGGCTTCAAGAACCCGCAGTCTACGAGATCTACATA
TACATGTACGTGGAGCGTCGAGGCTGAGGTGTGCTGCATACAGTGTGTACTACATGTAGTGCACCACCAAAACCAAAGAGTTCTGTCAAACTTCGCCATC
CACGAGAACTTGCCTTGCCTCGCTCGCCTGATCTTGTACCCATTTTGATGGATACCGTGGGTGAGCCACACCATTTTGATCTTTGATTAGCA