Description :
Non Conding Region
Location :
scaffold_1:18062- 18355
Sequence
293 bases(100 bases per row)
GTTGCAAATTGATCAATGCGACTGCAGCCGATTGAACAATTTGGATCTCCCTCTATAGTGTCATCCGTTTACCACAAGATCTCTCTATAGTGGCAATTGA
TTAGACGGCGTCAAAACAAGAAAAGTGAAAATGCAGACCGAAAACAATTTGCATTTCAATTATTAACGTATCACGCTTATCAATCGAAGACATCGAACTG
TGAAAACATTTGCACTTCAATTACGTAAGACGCTGAATACGAACTGCCATCTAGTCGGCAGCGACCTTTATAACGACGTATATCTGTTTAATC