Description :
Non Conding Region
Location :
Scaffold_1:17777- 21885
Sequence
4108 bases(100 bases per row)
GCGTTTGTATTTGATCGAGCACTGCTTAATTGGCTACTGCAGGGGCTTACAGTGAGGCGGCGCAGCGCATGAAGCGGTGGATTTCTCGGGCTTCGGATCT
CTCGGAAGCGACGTTCGCGTCGAGACTCCAATGCGAAACTGAGGCCGGTCGAGGAACGCGTCGCGCGTAACGGCTTCGAGTCAGCACCCTAATTAGCGGC
CCAGGAACGGCTAGTGAAGCAGTTGTGTTCTATTTTGTCGCTGACGTGCCTCGAGGCCGGAGCAGCATCCACACGACACCTTGACACGATGAGTGGGCAC
TCATTTGCGCCCACGCACCTCGACAGCccatggcgacgatggcCGAGAGCGTGTTTCGAACGCAGTCAAGCTGGACGCACGGTCAAGTCAATCGATCGCT
CCGTCGCTGGGGCGATTCCAGTGTGAAAGGCTCCAGTGGCTTCCGCCCAACGTCCAGACATTTCTGATTGgacgaccacttcaacttgccggTGTTCAGC
GCCCACGGACGGATTCGAAGGATAGAAAATAGGGCGTCAATGGTCGATTTTTAGTATCGAGGACGTTTTGGGGCgaccgaagctgctgctggcctaTATG
CGGCGGGCGGCATGTGACGAAAGCGCGGCAGTGCGTCAGACGCCGGCTCGGGCGCTGCCAGCCACGACCGGGATATTTTAACGAGCTCgggtccacgtcg
tcgttcCATCACAATAACGTGTTCGCCCGGGTTGGCGACTGTCGCCCAGAAACGCTTCAAAAGGTGCCAAGGCTGAAGCTGTCTGTCAGTGATCGCGACA
TTCAGCATCGGGGGATGGAACTGATAAGCCTGTCACCTGGGGCTGTCAGTGCGGTCGCAGCGACCTGCTAGGTGATAGCAGTGGGCTAGGAGCCATGGTC
CTGACTAAGGACTTTTCCTCGTCCATGCGACTCAAAACACACAAGTACAGCGAGCCCTGTTTGCCCTGATGTGTCCAGCCGGCTGACGGGCTTCGGTGCC
TTTTCTACGAGGAGGAACAGGTCGAGGTGGAAGCAGTACAGGCGGCAAGGAGATGGCAGTGAACGCGGCCCCTCGATGACGAAGCGCCGTGTTTCCACTT
ACAGTGCCGCCAACCGGAGCGTAGGCCGCTGAACCAATTGTACCTTGAGCTTGCTACGACGTCCTGCCGGTGCAGGGTGGAACCAGTGCCAGTCCTGATG
GCGACCGCCAAGTCAGACGCATGGCGTTTCAAGTGATCAGAGACTGCCGCTTTTGTCTCCATTTGCAAAGTGGCGAGCAACCACGGAGTCGATACATGCG
GTACTAGTGACCGGTGTAGAGCAGTATTGCACCCTGATTCAGGGCTGTTTGCTTGTTCAATGGATTTCTAGCTTGTGTTTGCACTTTCGTCTGGTACACT
GAAGCTCGATCGATACAGTGAAGCTTCCTTCTTGCGCAGAGGGCTTGTTCACAGGAACGAAACAAAGTTCTTCAGTGATACAACGAGAATAATGGTCACA
ACGCCTGGCCTCCAACCTTTAAGTAGCTTGATGTTCGCAAGTAAAAGATCCCGACCTTTGACACGCTACCGGCGCCCCGCCCACTCATTATTAATATTGC
AAGTCCGATGCTGCGTGATACGCGGCGGAGTGGCCACCAGAAGTCGCTGCGATGCATGCTTCCGTACTTGCTGGtatcgttgctgttgatgtgcTGTCGG
CCTGGTGCGGCCCAAACCAGTGCTCAGATCCTTTCGCGGTCAGGCTGCGGGTGTGAGCCGACGTTTTTGACCGATTCAAGTACATTTGTGACCTGCCATC
AAACAAGCACCAATTCTGCGTTGGGGTGTGCAGTGGACCCTTCCGATCCCTGTGCGGACGGTGTCTCGGGTCGAACCTGGGATCTTTGTAATGGTGGGTC
GGTCTTTCGTTGTTCTCCCCAGACTGGACTGCTTTGCTTCATACTTACACATATTTGCGCTGTGCACGCTTGTTTTGTTAGTTGTCAATTTGTATCTCGT
AACAGACCTGACTTTATCCACTGCATCGACTGGAGCGCTTCGTGTGACGTTGTATGGTGACGAACTAGCTGAGCtgactgcagcagatctGTCGAGTGAC
ATCCTTCAAAAGCGGATCTCCAAAGTTTCTCTCGTGTTGGAtagagaagctgcagtcaaGTCGATCAAGGTATGTTGGCTGCACTGTCGCCATTGCTGTT
CAGCTCACAAATTGTTGCTCGATAgattgaagctgcagcgaataTTTCGCTTCGGATCTTTGAAGTGCAGACAGCGGTGAATGACTTGCCCACTACGGTA
TtttctcctccgtcgtcggAATCAATTACCTTCGTTGACAGTACAGCAAACTCCGGTATCGTGTTGCTGTGGTTTGCGCCAGTGACGGAATTCTTAAATG
GTCAGCATTTGTACAATCCTGCGATAGAATATGACCGGTTCGGACTAACATGATACGCCTGTCGTAGGCGTTCTAAGCGAATGTGTGTTCGATTTGGTGG
GGCGTTGCGGCTATCATGCCGATCTACAAGCGAGTTCAAACTTGCTCTTCCTAGCGGAAGACGGAAATGAACCGATTGTAGCAGCTAAAGCAGTTTCTGG
ACCGGCGTTTCGGCGTTTATCCGAAGTGAAGAATCCCCCTGAACCTCGCTCTCTCTCGTCATTTCCTTGTTTGGTTGATCGCGCTCGTTACCAGCGGATG
GCGACCTCCAGCCCATATCAAAGCTTTACTTTGCCAAGTGACCCGGTGATAAGCGTTTTGGAGAATCGACCGGTTGAGGTTCGACTAGAGGATTTACTGG
AAACGATCAGACAGATTCGAGGGCACAGTAAAACGACGAGTCTCGTGTCTGTAGAAACAAGATGGAGCACCACGAGTGCATTTGGCTATGCAAAAATTGA
TGGTGCGTCGTCAAGGGAAGAGGTAGAGGATGAGAGTTTTGTAACGTTTTGGAGATTACGGCGTCGCGACACGTTAGTAAAGGTTTATGTCGTATCGGGC
TttgttggcgaaggcgaTTTTCTAATCCAGGTTGGCCTCAAAGAAGCAGGAAAGGTGCATCAATTCACGAAGAAGGTCTACGTGACCGTCGAAATAGACC
CTCAGCTACAAACTATTGACGAAATCGATTTAGAATCCGGAAACCAAGCATCGACCGCAGCTACTGAAGACAAGGACATCACTGCCAGAACTTACGCTAT
CGAGCCACGTCGACTCGATTCTTTGGATACATTAAATTCGGATGCTACTATCGTGGAATTGCTACCTTCAGCTGTCGATTTACATGACGGCGTCTCCTTT
CGTCTTTTGGCTTCAGACCTTTCCCCAGACTCGGACTCTGATTCTTGTCAGACGTTATTTACTGTCTTCTCGTTGACTAATGCCATTGCAACAGTGGAAA
CATCATCGACAGGCGTCCAAGACGTATCCAATATTCACGATCCGACTGTAGCACATCGTTGCAGCGATGCTCTGTTGATCTCATTGCTGGCCGACGTTGT
AAGCGTCCGGATTGAGATTCACGTCAGCACGATAGGTACCGATAGTAGTGTGACTATGGTCACCATTCCTGTCACTTGGACTGTGATCCCTCGCGTCAAC
TTACCAGTTACTAACCAAATCCTTCTTGGAGCGCACAACATACCGTGTGGCGAGGTACTGGAGCTAACGCTGAATTACGTGGAAGTACTGACCAATGCTA
GTGTGGAGATTATTGTCAAGAATTGTTCTTTTTTGAGTGTCAACCCTACGGGCGCTGCAAATTCAACGAGCGAGGAATGCGCTTTTCTCCTGAAAGATAG
CAGCTCTGATGATAGCGATCCTATTAGTGGAATTACGATAGCTGAGAGTCAAGACCAAGCTACTCCTGTTTCTGTCGAAGTGGCTATATCTCAGTTCGTC
CAAGGTGATGATGGTATTACTTGGACAGTCGCATCGTCCACCTTGGTATCATACGACCTCCATTTTTGTGAACCGGCGACGACAAGTGGTGGACCACTCG
TTTTACGTAACGGGGAGAAAAGTGATACCAATCTCGCTTCACTCGTAATAACGTTCTTTGGTGTTGATTTACCTAACACTCAGATTCCCAAAAGCATCTC
ATTTATCA