Description :
Non Conding Region
Location :
Scaffold_1:1760- 1941
Sequence
181 bases(100 bases per row)
TTTACTACCGCAACGAGGTGAAAGCTCTCCAGAAACACCTTCGAGCTAATTTAAAAATACATTTCTCATCCTGcaaaagttgaagttgaatATTTTTTTC
GCCTTCAGAAAAAAACATGTACCGTAATATCGGTACATTATTTTTATAGAAACGCCTCTTCATAATCAGTTAGCAAAACAA