Description :
Non Conding Region
Location :
contig_1:17574- 20049
Sequence
2475 bases(100 bases per row)
TACGGCTCCTTTTAGAAATGAGAGAAGGAATCAGCTGGAAGGTTGATACGTGTCGTGTGTTTGTGTCAATAAAAGGTTTCTAAATACAGATATTGGATGA
GTCTTTATTCTTTATACACATACAAACGTACAAGCTATGAAGTCTGACAGTAGGGACCAAGCTTTGGGCGCCATGATTTGGCGCGAAAAGCGTTTCGTAC
GCAATCCCCCTTTTGGAATACAGTGTGCAAGATATATGCACCAGAGCATTGCGTCGAAGATACTACGTAGTATACCTTAACGGAGTCATACGAACACGAA
GATATATGCACCCATTGAGTGACCCGCATATTCATTGCTCTACATTGCCGGGAATACAAACATACTGGCTGTGTAGCTGTACCTGAAGCGATTAGCTGTG
AGAATGCTGGCGACAAAACGAGCCAGATACAGAGCTATAGCCAACTAGTCACGTCCGGTAGAGAGTGGTGCGATATATAGCGCACGCGAAAGCCGAAGCC
GAGCATCATCCTCCGGCCAACGTTGGCGCGTCATCACCCAGAAAACGGTCGACGAGGCGAATATCTTCGTAAGTTTCGCTGTTATCTTTCCGTGGTGGAA
CGCTGTATCATTCCATTTTGACCAATCCCAGTAGTAGAGGGCTGTTTCAGCTGGATCACACCAAATAATTCACTTATTAGCCAATCAAAATGCAATCTAA
AAGGGCGCATTTTGCGCCCTTTTAGGTTGGACATCATCAGTGCCGACTGCATCGTGTTTGATTTGCACACACGCCCCGTCTCTATCGACAACTAAAAGGG
CGAATTTTGCGCCCTTTGAGTTTAATTGACTTGACGTTGTATAGTATAGTTCGTTGTGTCTATAGCAGCTCCTCGCGAAAGGGTTAAAAAAAAATCTCGG
ATATAATGTAACGGGGTTACCTGAAGAGTGCCCGTCACTCTTCCGAGTTGGGTACATGGTGTACCCAACATCACTGACACGTGATGGTGGCTCACAGCCA
CCCATACATAAAACATATAGGATAAACTAAAGTTGACTTAGGAATTGTATTGCAAGACGATCTCTAGGTAACTAATTATAAACATATCAGTCTATAAACT
ACGTTATCTAAGTCAACCGTTCCCCAAGACCGGGAACTAGTGAACCGCCGTTCACTTGGAGTTTGTATACTCCTAACACTTCTGTGGTGGAGTGGGATCG
CAAAAATGGATGATGCGATCCAAACTCACCAGCGGTACGCCCGGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCAGGCGTGATCAGAAAACCTTGT
AGTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTCTTGAAGGACGTCAAGGGTGTGACCAAGGCGGAACTTGTTGGAGCTGGA
CTGCTCCTTCCGGGGAATGGGGGGATGACGGCCACGCAGGTATTCTTCACGCGGTCGTCGGTTGTTGGTGATCGGGTCTTGGGGTAAGTCGATCACGTGG
GGGGTGTCCTTTGGGTGTGCTGTTATAGCCCTTTCCGTTGCTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGATGAGATTGTACGATCGCCCCCTGGC
CAAGCTATCCAGATGTGCGACGTGTCCTTGGTTGACTAGGTGAGCCCTTCTTCGGGTAGGCCAATGTAGTTCCTTCCCCGGGATGTGTGGACGCCACTTG
TGTCTTGCAAGGCAAATCAGAATCTATTTAAGCAAAAGTAAAAGTCCTAAAGATCTCTCTCCCTATCCCCATCCCGCTTGCGTGCCCACCGACTGCACAT
CACACTTGAACTTCCATCTGTATATCTTGACCTCGTATCGGAATGACAGTAACATTGTACCTAGCATCCATCCGATCCAACTGTACCACTGTGGCGGTAC
CATGTCGATCTGATCAGGTGAGTCCAGATGATCGCGTATGCCCAGATGATCGCAGATGTCTGGTTGATCGCAAGCGTCCGGATGATCGACTGTACCGAAA
GGGTGGTACCAGGCGATAAAATTACCTGTACCATCATTGTGGTACCAAGTCAGGTGCTGGGCTATCCGGACATATCCGGCACCAACCCCAACCCTTCTGG
TCCAATCAGTCCAGACGCGATCTCTTCCCATCATCGGCAATTTGACCCAGGTCGCTTCACCTCAATCGCCCCCTGCTCTGCGACCAGCCGTACGGCGGTT
GGTCTCAGCGCACTCCATCACATTTCCGCTTCCTTCTCTGAACCACCACCGGGGAATTCCGTGCCAGCCCCAGTTATGGCTGGTGCAGCTGACGCACCGT
CCGACGATCCTCTCGTCGTCGCGCCTGATACGTCCGCCGATCACACCTCCGAGGCTCCGGTCGTCTCTACTGCTCGCGTCGCACTTCCTAGCGTTAACCT
CGGTGCCGCCCGGGACTCTCTCGCATTATTCTCGTCCCTGCTGGAACGCATCGAAGCTCAAGCTGATCTCGACGA