Description :
Non Conding Region
Location :
Scaffold_1:17360- 19165
Sequence
1805 bases(100 bases per row)
ACTAGTCGTTTTAACCCGGCCGCCTTGAACAACTTGATGCGGGGACAGTGAATTTGAGAATGAGACTCCTCTTTGCGAGGTGCTGGTTGTTCAAGCGTGG
GTTATGCTATCACCAGCGGCGTAGTAACATTATCTATCCTTGTTGTCCGAATCGTTCTGGTGGCCGGTTGTCGACGATTTACTTCGATACGGTACAACAT
GTACATCTCTTTCGACAAACGACATGACGCATAAGTACAACGGAATTGCAGGTCACTCTGGACCACTCGGTAGTATGCTCAGTACATCGCAGTGAATCTA
TGGAGGGCTGGCAGATCGGAGCGTTTGGAGAATAACGACATCTCCGATTGCCTCCACCACCAATCCACGGTCAGCTGCACCCGGTTATGCTTTTACCAAA
CATTGTTTAGGGGGAAAAAGATTTAGGGGACACCACCAAGGAAAACAAAAGTGAACGCTAGCAACACCGACGCATCCGAACCTATATTTCACCAAAGTAC
AGGGCGAACGTCTGCTTCCACTGTCATGCTTGCAGAAGCCGCTAGGTGAGGTACACCCCAGACAAATTTCTCCACACAAACCTCGACTGAGGAACAGCTG
AGTCTTGTATCAAACGCTGAACAAGTCTTAGGATGTCGACAGTGTAGCAGCAAATGTACGCATCCAAGCATCTCCTCGGCAACCTTTATGGATAGGTGGT
ATTATATTTCCAGCGGGAGGTAGCGCAAGGTATTTCCCGCCAACTAACAAAACAAAAATCTAGCGATTTCACTGTTCGCAATGCACAATTCATCGAAGAG
ACCAATCGACGGAGCTGGTAACAGCTCGTCATTTTCCTTTGGTGCGAGATTACGTGGGCGTACAGCTCCGTTTTTGCTTGGTTCGCCTTCATCTTCAACG
CTGGACAGACTGACAAAAATGAGTACTGTACACGTACGCAACAACACGAGCAGCAAGGCAGTCCTGACGATCTTCACTAAAAGAACGCAGCTTCAATGGC
GCCAAACTTGCACCGTGTAGTACAAGGCACTCAGACGAATAAAGCTTCGAATCTGAGATCTGCATCTAAGTTATTTTGCTGCAGCGGTGCTGCTTCTCGG
CAACGCTGCGGGGAGAATCATCAAGACGGCGTGTATGCCCGCAAATCGTTGTGTGTATCTGGTAAGCAGATCTTTGCAAGGGGGGGATAAGAAAACGACT
GGGATGTGCAGCAGAAGCAAGACTGCCTTGCGAAATTCGCCAGGCGCAGATGAACCGCTTGAGATTTGCCAGAGTCCATCGCGGTGGTGGTCGCTCTCAT
GGTCCCGTATTTTACCAGGGGTATCGCGTAAGCCAGACAGGCACGCTTCTTGTTGGTTTCGACTGGCAGGATCCGAACGGGAAAGGCCCGACTGGCAGGC
GCTGTTTACTTAAACGTTGCTGCCGTGATTTCCGTTAGCACACAACTGTTTCTGACGAAGGTATCAAGGTTTGCGTTTGGCTGCAGCTCGCAACTTGACC
TTGTCACGCTTAGCTTGTCCGGATATTTGCTACATGTAGTCTGTCCACCTTCATCAGGCTCCCAAGAAATGGCGGTAGGATCAGGTTGCAGCCTGAACAC
CAAACTGCACAGACTGGATTGAGGGTCGGTTGACCAAAAGGGGTTACAGCATTGGCATTACGGCAATAGTTACCTACCACCAGTGCAGTGATCGCTGGTC
GCGGCAGGGCTCTCCTCCTGTTAAAACGTGTTGCAATGACAGTCGATCAGCTTTAGTTTCGCCATTCGCAAACTTGCCGTCTTCGTCTCAAGCCTTTCAC
AAGTA