Description :
Non Conding Region
Location :
Scaffold_1:17303- 17909
Sequence
606 bases(100 bases per row)
ATCGGAATTTGAATGAATGGCTCGTGCTAGGTTTACAGTCGAACAATTTTGATGTCATATCTTATTTTGATGGCTAGATAAAGAGACAGCTTGGCCGAGC
GGTTAAGGCGATAGACTCGAAATCTATTGGGGAAACCCTCGTGAGTTCAAATCTCACAGCTGTCGATTGTTTTTCATGTTTTTGAATCACCTTCATGCTA
CTGTACTACTCTGGTCTGAAATGATAGTAGTGATGTTTTATCTTGATTAAAGTATACTGTAAAGTATACTGTGACATTGAAGAGAGTCAAGTCCTTTATG
GAAGCATCCTTACTCAAATGCGGGAGCTTGTAATCGTTTGTATCCATAGTTTCAAGTGTCTTCTCCATCACCTTTTGCAAGGTAATACAGGGAACGACGG
AATGCAACGCCTGCCGAAGATTTATTGGTGTAATGGTGGACAACATCCAATCACATTTGAATGAATAAATACAGCTTGATGATTGGGGGAATTAAAATAC
TTCCCGTTTCAATACAAAACAAATTCTCCACAAGCACAATTAAAAATGAGACGACGGGAGTATCCAATATCAACGAAGCTCCGAGCGTTGGGAATGCTGG
AAACCA