Description :
Non Conding Region
Location :
Scaffold_1:17302- 18934
Sequence
1632 bases(100 bases per row)
AGCACGGATCTTGGTGTCCTGAGACACTGTAGCAATCTTCTCGCCTGCCACTATGCGCGTCACAGCCGCCTCGCACGCTTCGTTGGTGTAGAGCTTGCGG
CGTGTCGTCATGGTCGCTTCTTTCCCGAGAGTGCGCGGCAGCTCTACTATTCTCGCCACTCAAATCGAATCAAAAAGTGGTGCTATGGATCATAAAGTGG
ACATCTCGAGAGGCATCCAATCACCTCCCTTGATGAAAAAGTCGGCCGTTGTGATTGGCTTATTCGTAGGAATGGATCAAAAACTGGCACGGATCATAAA
GTGGTCGTTTACGTTAATACTGTACAAGTCTATAGTCGATATTCACAGCATCAAACGAAAAATAATAGCGTTTCGGCGTCGTAATGCCGTTCTCGAGCTC
GTAAAGCATTTTTAAGCAAAAGCTAGTACATTATTGTCATCTGCGTAAGCTGAATTGCTAAACGTGAATACCAAATTCGTTTCAATGAGTGTAGTTGCTG
GATACAAGAAAGACCAGGGGATAACTTATACTCAGCAGTCCTATCATCAAATGAAAAATGCTGTTAGTATCCGAATGTGCCTCATATGCACGATCCAAAG
AGCAAAAAAGTGATGAAATTACAATAGCGGAATACTTGAAGTAAGGGAGTGCTTTCGCGCTGATCTTGGATAAGAATGCAAAAGTCTTAGTCATAGTGCG
TTATCAGAATCAGTTGTGCAAGATTTCGCGATCTACGTATCGCTTCTTTTGTTTTCATTGAGAGAAAATGTTGATAAGTCGCATTTAACCTAGGCTGGAG
ATGGTAGGATGCAGACCACGAATTCATTCATCTCTCTTAATATAAGCAGTGCGAGCATACAGTGAACTTGTATAGTGCTGTGTTTATACCGCCTTTGCGG
AACACAAACAAAAATCAATATCATGACTGTAAAATAAGCTTTTAGTCTAATTTTTAGGCCACATTGGACACGAGGCACTAATTTTCAACAATTTGCAGAT
TGATTCACGTTCAAAACATCTTCATATCTCAAAGTTAAATAAGTGCGTCAAGACAATCATCATACTGTATCTGGCATACACTTACACTTACGGTCAGCGC
TACGTACGTACATATCAACGTTCAAGGCACGGCTGGTATGGAGTTAAATTAGCCCTAGGCTTTAAACTATCAAATCAAGCATTTGGGCAATAGCGTGACT
GCATCACCTAGATTTAGTGGTGTGATGGACCTTTTCCAATGTCATGAAAAGGAAGCAAGCATGTCATTTGGCTCCATGCACAGCTAATAGTGACGCTTTT
TGCGGCGCTCATTTGATATTTCTATCTATTCACCATATTGCACCATTCAATCGTTAAAAATGGGGTAGTCCCGTAGAATTAGTTTAAATTGAGTTTCCCG
GCCAACTTGGCATTACCTCGGCCTGCTTTTTCTGAACGAACTTAAGGCAGGTGGTTAGGTCCAAAAAGCACACCATCTACCATGGAAGGGTCTACTCATG
TTGACGACTATCACTCTTCTTTTCGAGATATTTTATGGTTGCAATCGTTCCCTCTAAACGACCAGACAGTCCTTCATTACTTCGCATTATCACCATATTA
CGATCGTTCTTGTAACAACGAAAGACTTAAGA