Description :
Non Conding Region
Location :
Scaffold_1:17215- 19769
Sequence
2554 bases(100 bases per row)
CGTGTTTACTCTCTATGCCTTTTTATCGTAGTAGTGAACCACGATGATGATACACTGTAGAACCTTGTGACCGATTATGATGAGCTtCATATGTGAGAAA
CACACCAAATAGATCTGATCTAATGCGCTTTCACCAAGAAAGTGAAGTGACACACTACACTGTATATCCTGTTGATACCAATTCCGATTATTTGTATTAG
AGCGCCACCTCCTCCACTGGCCAaGTGAGGTTGGCATTCCACGCGTACTTTCGGTGAGTGTCAAGGGACCCCAATCTCTTTGTCGCCGTTGCTCTAACAT
CCACTCTCGGACAAGACTCACTTCCTTGGAGTGGCGCCAATAAAGTATTGATTACCATATTGTGAACTCGCCTTGCTGAATTGAAGCGGTTGGGGTGACC
CGGCTCACCGAATCCGCCAGACCCCTGAACAAGGTCGACTtAATTTTTTtCAAAAATGTGCGGATATTTTTGATAAAAaTAAAGTCGACCTTGTTCAGGG
GTCTGGCGGATTCGGTAaCAaTTATTGCACGGCAGAAGTATTGTTGCAAGGCCCTCAGACTTACAATATAGTTTtGTTTACATGAAAATACTATTGATAT
TATCAATAGTACTTTCATGTAAACAATATCATTGTTTATTGGTGCCATACCAAACGCCTTCTCACCATATATCAAAAAATGATAATCATATTTTGCTCCC
ATATGCTGGGCTGAACAACTCGATTCGATCTCGAGTTCTACAGTATAGCTTTCCGATGGATTGACGCCATCAAGGATTCATTTGGTCCTCTCGCGCGAGC
AGCCGAGAAAGAGATATGTACATACATACTTTCTATTCATTAATCAATAACGATCTAAGACACATTTCACCTATCTCGTCGAAATAAGTACTGGGATACC
AATACATCCCTCGGAAGTCCCCACTTTAGTAATGTACAGCTTGGCCTCAACCTGGCTTATACATCCCCCAGAGGCTATGTGACCCGCCACTTTCAGCCCT
CATCTATAGTACCTCTCAGCTCTTCGTAGAGGTTTCGATTGCGCAAATTCTGTCTCCGCAATTGTTTTCTTGTTCGAGTGTTGAATCTCATcGCCCAGCT
TCATGAGCACGGGCTGCATGCAGTTGATGATGAATGTGAAGTCTATTTTGTTACTAGAAAGGACTACAATACTACTCGAGGGCTTGTCACTCTCTAAATT
CTCCAAATCGGGTtgCATGgAgTACCATACATGCTTAATtGTCACCATGCTACGAAaCGaCAAGCTGTACAGTACGAACTGGTCTTGCGGCTCGCGAGCG
gTCTTTCGACTCTGCGACGCCGCATGGATTGGGgATCGTtgACTCCGACTCATCTATAAGCTAaGTTCGCGCTGGTGCTGGCTACTtACAGTGCCACAGT
GTTtCGCGCATGTCATCCATAGaTAATAgAGACCAACATTgTGGGCATGAGTATCATTGCcACCTGCCTACAGCGCGCGTTCCGAGCCTTGAATTGCCAT
CTCTGTGGATGTTCGGCTTTTTtCATCGAATCGTCAGGGTCGGACACCATCGCTATTCAATACGGTACACTTGTCTCTGATCGACCGCGGCTGCGTCTCC
GGCTCGGGCTCGGGCTCCCGTCACGGAGCTCATGATCCAAGCCTCCATCCCCCTCGAGCCCTTGACTCCGGGCCTCAaGTATTATGGCTCGTCATGGGTC
TGCCTTCCACCAGACGCCACACCTCATCTGGCGCCTCGGGAAGCTTCTAGCGCACCGCCTGCATGGATGCCTTGACTCGTGCATGTGGTCCTGAGGTCTG
AGTATGTGGATGCAGACTTGGTACAATGTGCCATCTCTCGGATGGTAGTCAGATCAGAGTAGCCAGATGGAAACTAGGAAAATGACATACAAGTCCTTCA
AGTTCCATGGCGTATGGCATCAGCTCGGTCTTGCATGCAATCCTGCACTCCGCCACGTCAAGCAGGCGCGGCAGAAGAAAGTTGAGTTGACTTACCCAGC
TGGTGCCAAACAACCAACGTGCTGGACAGCGACAAGAACCGAATGCTATGCCACGGGCCGGCCAGGACACCTGAGTAGACAAGGGTGTCCCAATCCATCG
TCGTTCCCACTGCTCATTCCACAAAGTGCCTTCAAAGACGCACATAGCCAAGATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGGGCTCGGAGCTCCGTGCCGGTGGTAACAACGCCAATGGTGGTA