Description :
Non Conding Region
Location :
Scaffold_1:17175- 17311
Sequence
136 bases(100 bases per row)
GCGATCCAGTCTGAAAATGATTGAAAAAAAGGAAACAGACAATACATTTCTAGAACAATCTGTGTTTcgtaaaaacaaaatatataTTGTGTGATCTGCT
GACTGTTTCGCAGTTTCTCAATAAGGCAACAAACGA