Description :
Non Conding Region
Location :
scaffold_1:16919- 17075
Sequence
156 bases(100 bases per row)
AAACTTATGCTGGCGAATATGCATCGGGATAACAAAATTGGGCAGTCAAACTCGAGCAGACCAACAGCCAGGGATTTCTTTAGGGATACGATACCAAAAA
AGAAATGCCGTCTGCACTTCGCGGATGCATTGCTTCTCAGCCAAATTGCGCTTTTC