Description :
Non Conding Region
Location :
Scaffold_1:16880- 16991
Sequence
111 bases(100 bases per row)
GTCACCTCCAGCCAGTCGTCGAAATGACGCACCCTTCACAAACGATGAAATCACAAATGACCAAATGTATATTTATAGTCCTACTCAAACTTATAGTCCA
CTTCACAATCA