Description :
Non Conding Region
Location :
Scaffold_1:16569- 17464
Sequence
895 bases(100 bases per row)
TGCGTCACATTTGCTGCCGCTGCGCGTGCGATCACTGCCTGCAGAGCGCCTCCTTCCTGCTGCTGACTGAACCTTGAGTCGTGGATGTGGCAGTGCGCGT
CAATAAATGCGGGTGCTNNNNNNNNNNNNNNNNNNNGCGCGCCTCTGGGGATGCCGAAAGTTGGGCCATTAGGAATCGACACTGCACGTTCGCCCCAATG
CACTTCCTCATGTGGAAGTCGAATTTTGGTTTTGTCGTAAAGTTCGATTGGACAAAGTCGGTTAAGTAGAGTGCGAACTTTGAGTCTTAGCTGACCCTCT
TGAATTGCATACTTCTTGTAGTGTATTTGTCCCACCCACCAGAAGCCAGTCATGCCCAAAGTATTTGTGCCTATGCAGCGTGCGTCACGCCCAACTGACC
ACTTGTCACAGAAAGTGATTGAAAAAAAAAGAAATATAAAGCGAATCACCCACAATACCACTTTTGTGGCATTTGTCCCACTCAATACAACCCACGCAAA
TACCCCTCTTGTACCGTCCAATTGTGAATAATGCCCCCTCCAGCTGGTAAGTTTCCTGAGTGGAACATGGAAATAAAGGAATGCCCCGCGCGCGCATAAA
GCAGCAGCGCATCCTCCTCCGCCGCCCTTCTCTTCATACACAGCAGACAGCTGACAGCAGCAGGACCCAGTCAGCTATAGTACCGTTGCCCTCTGTCTCT
GTGTGTGAAGAATACCACGCAGCAGCAGCAGCATATCGGAACCCACGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAT
TTGTCCCAGTGCGCCAAACATTTACGCGTGCATGCCCGCCTCGCGCATCGACAGTCACTAGCAGACGCGTACATATATTATATACAGGTTTATCA