Description :
Non Conding Region
Location :
Scaffold_1:16270- 16711
Sequence
441 bases(100 bases per row)
CTCAGTGACTAGACGGGGGTACAGCGTAACCAGCCCATGACTGGTTGCAGTTGGAATGCACCAACTTCAACATAAGGATGAGATACATGTGGGCCACATG
GTCAGGTTGCGTGCGGCCCGCGGATCGCGCCAGCACACGCACAGGCTTAACCACAGAGGCATGCTCCACTGGCGGACCGACAACTGGAGAGTGGATGGCG
ATCGTCCAACCAGCCACAAGACGCAAGAGCAAGGGACGGAGGAATGCGCCGCGCTCGATGGGGGACGACCTGAATATAGTACGTGGGCGTCTCGTGTTCG
CTCATTGAGGCTGAGCGACGGAGTCCCACTACGCGCTGCGGGTCTGCCGACGGTACCAACAGAACGCAAGGACATTGATTCGTTTCGTTTACATTACTAC
ATGGTGTCGCCGACCTTGATCCCTTCCTCTCCCCAAAACGC