Description :
Non Conding Region
Location :
Scaffold_1:16196- 18474
Sequence
2278 bases(100 bases per row)
GCGTCTTCGCTGACATATACACAGTTGGGAGTTATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAATGAGGGAAATG
CTTGCTAGATGTGCGTACAGTGCCACGACCATAGAGACCAATCGATCGTAAAGTCTTCAACAGCAAACAGGAAGTGTAGAAGTTGTCTGTGTTTACAATG
CGACTGGATCCTTTCAAAGATGAAGTAACCGCCATGACGTGAGAGCGGATTTCAGACGACTTCGCGGTTAGATCAGCGAATTTCTGCACTTCTGAGCGTG
GAATTACACCGTCCAGCCGATCATCAAGTTCACTGGAGCAGTGCAACTTGAAACTCACCGCGTACCACGAGGTAGAACAGCAACACACGTATAACTTGAA
ATGATACTTTCCGGTGGGTTTTTGTGGGTTGAAGACTATAATGTGGCGGGCGTACTGGGATCGGCAGGCAATTGTGGCCTCATCAACAGCCACGTTTCGA
CCGACTTCGACATGGCGCAGGCATCGCGATTTCAGAATGCTCATGAGTGGTCGTATTCTAGCTACAGGACCGCGCTTGATGTCGGAGGTAGACACCTTGG
AACGAAAACTCAAATTCTTACGGATGTACAGGAATCTTCGCCATGTCATAATTGACTTCAAACTAGTAGTACGCGCTCCAGGAAAAAATAGTTGCTTCCT
CGTCGTCCACCCAGTAATTTCTCATCTCACCCTTGTCGTACAGAGTCATGTACCAGAGGATCCCATCCGGATGTGTAAATAGCCCTGACGGTTGGCCAAG
CGATGCTGTGGGTGAAAATGTCATTGACGCTATCTCTTCGACTTCACCAGGGCACAAAGGGCGCTGCAATTCTTTTCTGTCTTCGGGCCAAAGACCGGCT
CCTCCTGTTCCTCCGTATTTTTGCTTCTTTTGCGGCCGCGCGCCCTATCTTTTTTTTGGTCTTGACATCAGCACTCTGGGTTCTTGTCTTCCGCTTGTTA
CTTGTCGCCGCGCAGGACTCAGCGGCCAGATGTCTCTCCTTCATTGTCGCTGTCCGGGTAGTCTTTTTTGCTGCGCACATCTGCTCGACCTTCTGGTTTC
GGTTTGGCGCAGTTGGTAGAAATGAAAGGGGTCAGGACGGTAAAACACATATTAAGTTACGAGTTCGGTGACGTAAGGTACTATTCCCCGTTTGCCCTGC
CAAAACTGATTCATGGAAGTATCGACCGTTGGACAATCCATTTGCGCTGGCATCATTCAAGCATCGCAGCCAAGTGGCGTGAAACAATGGAGCGCTGGGT
GGATGCGCGGACACAAGCGATTGAGACGATCACAAACATCCTATGCAATAGAGCTTGGCCTCACGACAAGCTAGTGGTGCTCTTGCGAGGTCTCCCTGGT
AATGGAAAGACTACGTTCCGCGACCACTTAATTGAGGAACTTCGGCGAGCCATTGACTACGTGGATGCTGAAGAGGATTCGCCACGGCGCGTTCGCTTCT
GCAGCAGCCCCTTGTACCTAGGGTTGGCAATTCACGTTTAATTACCAGTTATTAACGGTTACATTCAGTTAAAAAGAA