Description :
Non Conding Region
Location :
Scaffold_1:16182- 16270
Sequence
88 bases(100 bases per row)
TAGAAACCTTCCTCTGCATGATAGATCATAATTAAAAAGGGTGGCCAAAACGCATCGGAAGTCAATCCCATCATCTGGCAAACTCAGT