Description :
Non Conding Region
Location :
Scaffold_1:16139- 16637
Sequence
498 bases(100 bases per row)
TTGCTCAGTCTTCGCTGTTGCGGAGTTATCCCTCCTGGAGCCCTGGGGTCGGGATGCAGCACCAGCATGGGCGCCACGACGTCGCTCTTGCGCCGTCGAC
TCGTAAACATGATTTACAGTAAATGGACACGGCTTGGCGTGCTGCTGCTGCTCGGGATTGAGGTCGTGAGTCCGCATTTGATACGCAAGAAGTGCGAGGC
TGGAGCCATTTATAGCAGAGCACCTGCAGCACACAATTATCTCAACACGAACACAACAAGTGAATGACAAGACAGGGAGTGAGAAATAAACCAGCAACAG
GAAATCCACGCGAACGTCAGCCAGTTCCGTCAGCATCGACATCAAAATTGGATGGTGGATTGGATGATTGCCTTACGATACAACGCAGCCGCTGTCTTTC
CCTGTCATCACACTTTGACTTCTTGTCTGAACTTGGTCGTCGTCCGTGGCATACTGTGCAAAATGGTTCATATATTGTCTCGGGTTCGCTTTACTTCT