Description :
Non Conding Region
Location :
Scaffold_1:15625- 15654
Sequence
29 bases(100 bases per row)
GAGTACGGATACGAATGAATAGGAGCCAT