Description :
Non Conding Region
Location :
contig_18:155391- 156391
Sequence
1000 bases(100 bases per row)
CGTCACGCGTTGGCTGGAGGTGTCGTGGGTCCCTGCAGATGTCACGAGTGTGAAGTAAGTCCCCGATGCGGTCTCTAGTCTTGTCGGCTGCGCTGTGAGC
TCGATGCTTGGCGGCGGAGCCTCTGACCTGAAGTCCGAGGACTAAAGCTGAGGCTGGAGGCACAGTGAGTCCCTGCGGTGGCCACGAGTGTGGGTCACAG
GTGGATTTAGTCCATGTACTGCTGCTTCAGGCGGAGTCCTCTGACCTTCTCCTGAAGTCCTTGACTTGATCCGTGTGCTGGAAGGTGCCGTGGTCCGTGT
GGTGGTCACGAGCATAGACTTGCGGTGCTCAGGGTCCCTGGTGTGATCACGAGTCTGTCGGCTGCACTTCGAGCGCGTCGGAGGCTCAGCACATGCGAAC
GCAGGCCGCTTCTTGGGCAGAGGATATCTTCGCGAGTGAGCTCGATAAATTTCAGTGCGGCTGTGGAAGATCGTGCGATTTTCAGCCAATCCAACGCGTA
GGATACGAACACGCCAGATCCGCATAAATACGAAATGCGCGAGAACGAATATCGGGAGGGAAGCTCGCAAAAATGTTCGTTGTTCTCGCACTTTAGCGAG
GAGAACACGAAAATCACGTTTTTCATGTTCCCTCTTTTTCGTGGAAGCGTTTTTCACCTTTTTTTTTGTTCCCCTACCCGCATGTTCGTCCAAGGCTTGC
AAAAAACCGTCACGCCGGACTTGTGGCCAGTCGCACCTCATCATTTAAGTGCTCGACTTTTCAGTGTCCGCCACAAGATTTGAGAACAAGCCGAAAACGT
TGCGTTGGCATGGTTGCACACGCCAGTCTGGCCTCTTTCGACCGATCTGTCGCATATATCAACGTGTAGTCTTGTCAAGTTGCGGCGTTGGATTCTTTTT
TTTTTTGTCGTCGTAGGTAAATACTCGTGGCGTATTAACCTGGACCTCTTTTCGACTTAATGGCGCGTGCCTCAGGTGAAACTCAACTAACTTCAATTTA