Description :
Non Conding Region
Location :
Scaffold_1:15500- 15570
Sequence
70 bases(100 bases per row)
TCTTTACAGTTGGTGAGCAGATATTTTCGAACTTAAACGGAATCCCAGGAATTATGGCCATCCTTTACGA