Description :
Non Conding Region
Location :
Scaffold_1:15351- 16758
Sequence
1407 bases(100 bases per row)
CTGTTGCTGCTGCAGTTCTCTTGGGGCTGCTCGCTCGTGTGCTTGTTGGAATTGCGAGTGTGTTTTCGTGGGGGGTGGGTGGAGAATGGTGAGGAAAAGG
AAGAGGACCAACACTCACGCTCAATGTTCTCTCGCGGCCTCTATCTTTCTATACTCCTTCACGGAATCTTTGTGTAGATTCCGGGTTTCAGTACTAACCA
AACTCTATAAATGAATCCCTTTGAAAAGAGATGCAACCAGATGGTGCGAATGATGTACTTTCAGTGAGCCAGAGAGAACTTTCGCCAGCGAATGGCTACA
CTCTGGCCCACTTGATCTCGTCCATGTCCTGATGGACAGCGTTGTCTTAAATGAGCATCAACTGTGTCGGTATCACTTTCTGCTATCTCGAAGTACAAAT
CAGGTAGCTAGCAGTCAAACAGAGGTCGGCATTTTGAGTTTGATTGACAGCTTATTGACGTTCTTCATGAGTCCTCGTCAACCTATTTGCCTGCCTGTCG
AACAAAGTAAAGCACATGACCTTCAAGCTTCCCACGTGAAAAAGAGATCAAATGCCACACACTTCCCATTCGGTCGGATGACTTTCGTTCTTGGAGACCA
CCTCTTGATCCTGGCGAGAGGAGGTGACGACGGAATGAAGCTTGTGCCCTTTGCGTCACAAGTCCCGGAAGTGAGTCAGGTACGGAACCACCATGGCAGT
TCCTCGTGCGATCAACATGCTCTCATTAAGCAAAACCTGATGAAATGGTCACCACAGAGTATTAATTCTGCCAGGAGAAACAAACATCGCTCGACAAAAA
CACACTGCATCAAAAGCTCACAACGTACCGAGAACAGTGTAGCGGCGGTCGATGATCATAAGCTATGCAGCAGTATGTCACAACCAAAAAGCGCTCATCT
TCGTGGTAATGAACTTCGTCCAATCGGGATCGCAACAACTCCATCGTCATGTTTCAACCGGGTCCAGTTTCCGTGAGAAACTAAATATCACCACGGATTT
TTACTGCAGGTTTCCCCAAAAAACTGCATTATTCCTTCATTTGCCCTTTGCCTGGTCACCTCTTACGGTAGCTCTTCATTCCTGGCTGTTCGCTTTGTGT
ACGCACTGCACGTGCTACAACAGGTCACGTTGCTGGTGCTTTCCACAACATACGCACACATACACATAGCTCTTTCCTTTTCCCCGTTTCCAGTGCACTA
AGTGCAGCATGTGCTGTGTGATTGTTTTAATTATTGCAGTAGTATGAGGTGCAATCTCTCTACTGGTACAGTGTACCCCATGTCGAGGAAGGTGACAGAG
CGCGCGTCGTCAGCATTGTTGGGCAAGCAGCATTTCTCGTTTCCCCCTCAAAGCAACGCAACCAGCAGCGTTTGCTAACCCAAAGGAAGAGACGCAGCAG
GACGCGA