Description :
Non Conding Region
Location :
Scaffold_1:15283- 16301
Sequence
1018 bases(100 bases per row)
GTGTACTCTTCCTTGTTTCAAGAGAGAATTTATCGAGCCAAAGCACTTAGCCACTCCTCGTATGATGGCTGCTTATGACTATATCTTTGGTACGTATCTG
AAATATGTGTATGTGTAGTTGGCTGTCAGTTCCAAAGTGAGGAGGACGAGAGAGCTAAGTCGCCCCAGCTCGCGTCCTCCAGTCAAATTATCCACATCAT
CCAGCATACGATCTCTTAATATAGTGCACGCATTCATCTAATTGGCAGTAATACCAGCATATCTTATGACCAATAGGAATGGCATAACAACATTAATTTA
TTTATGTCAGATCAGGAGATATTAATATTATTTATACACTGGTGTATAATTTATCCAGCCCTTCGTCATCAATGATGAAGCCGTCTAAGCAACGGAGCTC
ATTCTCTCTCTCTCTCTCTCTCAGATGCAAAGTCAGTAATGCTTCGTTTTTATTTATTACCATGCTTCCTCGAAAATAAAAAGTCATAAGCGGAAAAAAT
AATCGCCATACTACCAATAAATACGTTTTATTATTGCCATGACTATTTTTGCCAAACCGAACCTCTGGGGCATACTTAAGTGTAAGACCGATAAAGATTT
GATGTTTGAAATACAATACTTGTGGTTTTAAGTACTATTGCAACAATATTTATTGTCATATTGCAATGACTTTTACAATATAATATTTTACCGATCTCGT
ATTATAATTAATATTATTGCTGAAAACACATTGCAAACAATATTTCTGAATTATCCATCGAGATTCGCAACTATCCACTGGCAGTGCGGACACGGTCAAC
CTGGTCGACCTGGGACGGAAATCGCTGCGAAACAGACTTCAGTTGAAGAAAAAACACGTCGAATAGCGCCACGGAAGGTTCATTGATGTCGCTCTTGCGC
TCTCCGTTGTTGATGCGGGTGACTAGGAAAGCTAACTCAAACCAACGAAGGATGAAGGTGACAAAACATTTGATTAGAGCTATGTAGGATAGTATCAAAA
TTTCCCTCACCTTTTGCC