Description :
Non Conding Region
Location :
contig_18:152359- 153074
Sequence
715 bases(100 bases per row)
GGAGATAGTGAATTCGAGATGAGGATGCTAGAGGCATGGGAGAAATCCTACCGACACGCACCACGACCTGTCTCTCCTGTTCAACTGCCTAATAGAGAGA
GTCGCCGTCCAAGCAATCTTGATGATGGAGTCAAAGGTGCATGCAGCGTTGGAGAGGATCAGCCACACATGGTGGCGATAGTTCACATTACGTTGGCGTC
AATTGCTGCGACACAGACAGAGGATCAATCGCCACAGACACTACAAGGAGCTAGTTCGTCACTGACGACATCACCCGAGCGGTGCATATCGAACAGGGTG
GCGGTTGTGAGGCCAACCGCGGGCAGTGGTAGCGGGGACTCGTGCTTCGTCACAAACCTAGGAGTACCAAGGATATTCGCCACCACTTCGTCCGACATCT
ACCGGCCTTGTGCGGTTGCAGTCACTTCGAGGACGCGCTCGAGCTCCTGCACGCCGCACACATCATCGAGCGCGAGCACACAAACAGGTGGCGCAAAGTG
TACTCGTGTTAGGCCTTCAGCTTCAAGTGCAAATGAGAGCGGAGCAGACAGCCCAACACTACTTGTCGAGCAGTGGAACGTGAATGTGGCAGCGTTGTCT
AAGTGCAGCTGGCCGGGCAAGGTAAGCGTGGCTACGAGAGATGCTTAACGGAAAGCATAACGTAATACGTGTGTGAATTCACTCACTAGTCATCTTGTCA
ATTTCTTACTACATT