Description :
Non Conding Region
Location :
Scaffold_1:15112- 15773
Sequence
661 bases(100 bases per row)
CGCTGAACGCAGGAATGAGGACACACACAGCGGCGAGAGGAATATCACCCCTCTTCAGGACAAAGCGCCTCGACAAGCGGTAGAAGCTGCGCTGCGTCGC
CTCGTGTTTCTCTATTTCAGCGCTGTGCAGTGCCTTAGAACCCCAGCTGGCATCGTTGCTTAGCTCTAGGAACAGTCTCGTTAGCTTTGCCACCTCGTTA
ATACCGGCTGAATATGTAAACGCCCAACGCGACCACATTCGCCTTGAACTTGTTGTCGACAGCATTTCCAGCGCCATGCTCTGACGATCTCACACCTTCC
TCCTTCGTTGGGTGAGCGTGGGTGTGCAGTGCACTAGCATCGTGATCGAGCATGTTGCACCTCTttgacaccaagcagaaactGATTAATCGGTCTGGAG
TTTGCTGCAAGTCGAACTAATGCTGCTCAATTCCCTTGTTGAAGCTTACTTAATACTTGTAATAATGCAAGTGCACGGCCCACCCCACGTGCATGTACAT
GCTTCTCATCCATATACTGACTCACATCTGCACTACTTGTACACTACTTGACCACAACTAGTTCTCGGTCGGCTGCCCATGTGCGTACGTCTTGTTGCTT
CTGGTTTCCCCCGTTGTCGTCATATTTCTTCCGACAGTCTGGAGTAGACAGTGGTATAGCT