Description :
Non Conding Region
Location :
scaffold_1:149801- 150000
Sequence
199 bases(100 bases per row)
GCTGGCCGTGTCCAGGGGTCCTTGAGGTTGTGCTAAACTGCGGCGAAAAGTGGAATACGTCGGACACAAGTCGCGGAATGACCGTCACGGTTACTTCAAA
AGGATCTAGAGCCGGCGTGACTGCGTTTCAGTATGACGAGGGCGTTCCGTCTTTGCGCCAGATTCACTCGGATGGGGATTACGCCTTCTTTTAATCCCC