Description :
Non Conding Region
Location :
Scaffold_1:149785- 149920
Sequence
135 bases(100 bases per row)
GAAGCAATTGTGTCGTTTCAAGCTAAACGTGTCATGATTGGTGGATAATCGATCCTATACGTGTTTTGATTGGCGGATGTATGTTTTGATGGATCTTTAA
AGGTCAGAAGCGAATCATTTTCATCTCGATCGAAA