Description :
Non Conding Region
Location :
Scaffold_1:149697- 150000
Sequence
303 bases(100 bases per row)
CGTTCCCCTCCTGCTTCTTGTAGACAGATTGCTTGACTCTCGAAATGCGAAATCCGCAAAAGGAAACAAAACGCGACGGGCTTGTCCCGAATTGAACATC
CCTCACAAAACAAAACAAGGGAGCCATGTGGCCAGCTTAGTGAACAGAAAATACGGGACACGAGGGAAATGTAGCCATTTTAATATCTTGGTGAGCTGCG
CTATATATCCTGTTTTCAACGCCCATCAAATATATTTGTGGCCGTTCACTTGATGAAGCGCTGTTTGCTCTGAGCGGGTCTATTAATAATTCATTTACAC
TGG