Description :
Non Conding Region
Location :
Scaffold_1:149680- 150000
Sequence
320 bases(100 bases per row)
GGTCTGCAGGAGCTCTTGGCTACCCTTGTCAAAACGGATGGCTGACTGACCGAGATATTCATTGCTACAGTTACGCAAAAACATAAACTTTGAGAGTACT
CATCTCGGTGGTCGTATGTGCGTCGAACGCAACTTCAAGGTAGACCGGCGTCGTGCAGCAGGTCGCCGAGAATCATGGCCGTGAGTCTCTGCTGCAGCTC
TTGGTCTTGCTGCGTTTGGAGGGAGGAGAGGATGGAGGTACTTCTGGCGCGGGATGTTGGCGTGCGTGGGAATATTCCCGACCGAGAGGGTTGAACCGCA
CTTGACAGCTCCTCGGTCGT