Description :
Non Conding Region
Location :
Scaffold_1:149538- 150000
Sequence
462 bases(100 bases per row)
GAAGCGGTGAGCCTCACTGCTCTTGAGTCTGACCATGATCCCATGTGGACTGTCGACTCTGGCTGTTCCCGTCATGTCACCTCGAGCTCGAAGTGGTTCA
AACCACTCAAGCCAATGGCGGGAAAGGCCATCACGGTCGGTGGAAACCACCAAATTCCAATCAAGGGAGCTGGTGATGTGGAGCTGAAGATCAAGGACAC
CAAGGGAAAGGAGCGGGTCATTGTTCTCAACGACGTGCTGTATGCACCTGAGCTGAAGTTTAACCTGCTCTCCGTCCGCCAAGCGGTTGGAAACGATTTC
AAGATCAACTTCCCCAACGCCAAGAAGTGCGCGCTGTTCTTCGCCCACCGCATCAAGTTGGAAGCCAAGACTGGAGACGGCAAGTCCCTCTACCAGTTTC
AAGCCAAACCAACGAACTCTGACGAAGGCGCCCATGTGGCCGCCTCAGGTAAGTTGGACAAT