Description :
Non Conding Region
Location :
Scaffold_1:149532- 149964
Sequence
432 bases(100 bases per row)
TCTGAGCAGCTTGTATGTACCCACGTAGAACAAGCAACATTACCTTGACAGCATCCCAAACGCTGCGTTGCTTGCCAGACACAGTCTCTATACAGTCCAA
TGGAGAACCCACCGATGCACCTCGTCGCTCTCCCAACCCGCGCTAACTCTTGGCTTCGTTATCGCCATACAACTCCGAGAACAGAGCCCTCCAACGCGCC
AGGCATACGCTTCCCACCGTCGCCATCATCATCATTGAGTCAACGACATTGACACAGAGCAATATGGCTACACAATGCTATCGTGTGATTCGCTATAAAT
ACGTCCCGGGTGTTGCATACAGCCAATCCGATCGCGTCATGAATGACCGTCATTCTCGACGTGAGTAGCTCAACGCCACATGCGTGGCTGATCGGAATTC
CTGTCATTCTACGATCACcAGACGTGAGCTCA