Description :
Non Conding Region
Location :
Scaffold_1:149453- 149948
Sequence
495 bases(100 bases per row)
GTAAACCTAGTACTGCGTTCCACTGTACTTGGAAATGGAAACAGCATTATCCGGATGAATGGAGTGAAAAACGTCGCGTGAAAATTACCACGAAATTGAA
CCACTGCGACGTGATGGGTTTCATGACTCTCTGTGGTGTCTTGTGGAAGAGAGGCTTGGAGGGTTCCAGGGCTACTGAAGACGCTCCTCACAATAACGTT
ATGGAATACTAGCTAGCACTTCGAAGTACTCGCGATATATTCAACTTGGCGAAAATGTGATGGGAAATACCTTATTCAGTATGTATCACACTTTGAGTTT
ACTGTTCGTCGACGCCGACTATTGATTTGTGTATTATCCGTATCCGGTTGGGAAAAATTGATTGTCCAATGCTGGGACAGTCCTGCAGTCAGGCGTATTT
TAATTCGAATCCACCAAGTTGGATACTAATCGCAAGTTAGATCGTACAATTAAAAACAAAATGCGTCCCACCGCACTCTCGCCACATTTGTTCGT